Home Contact Sitemap

eRAM

encyclopedia of Rare Disease Annotation for Precision Medicine



   genitopatellar syndrome
  

Disease ID 1228
Disease genitopatellar syndrome
Definition
Genitopatellar syndrome is a rare disorder with characteristic craniofacial features, congenital flexion contractures of the lower limbs, absent or abnormal patellae, urogenital anomalies, and severe psychomotor retardation.[1] - Wikipedia
Reference: https://en.wikipedia.org/wiki/genitopatellar syndrome
Synonym
absent patellae, scrotal hypoplasia, renal anomalies, facial dysmorphism, and mental retardation
genitopatellar syndrome (disorder)
gtpts
Orphanet
OMIM
UMLS
C1853566
SNOMED-CT
Curated Gene
Entrez_id | Symbol | Resource(Total Genes:1)
23522  |  KAT6B  |  CLINVAR;ORPHANET
Inferring Gene(Waiting for update.)
Text Mined Gene(Waiting for update.)
Locus
Symbol | Locus(Total Locus:1)
KAT6B  |  10q22.2
Disease ID 1228
Disease genitopatellar syndrome
Integrated Phenotype
HPO | Name(Total Integrated Phenotypes:38)
HP:0000028  |  Cryptorchidism
HP:0001263  |  Global developmental delay
HP:0001274  |  Agenesis of corpus callosum
HP:0000946  |  Hypoplastic ilia
HP:0002089  |  Pulmonary hypoplasia
HP:0004322  |  Short stature
HP:0002213  |  Fine hair
HP:0000365  |  Hearing impairment
HP:0000445  |  Wide nose
HP:0001631  |  Atrial septal defect
HP:0000750  |  Delayed speech and language development
HP:0000347  |  Micrognathia
HP:0000126  |  Hydronephrosis
HP:0000369  |  Low-set ears
HP:0001762  |  Talipes equinovarus
HP:0000316  |  Hypertelorism
HP:0000343  |  Long philtrum
HP:0000684  |  Delayed eruption of teeth
HP:0003175  |  Hypoplastic ischia
HP:0004279  |  Short palm
HP:0002804  |  Arthrogryposis multiplex congenita
HP:0011968  |  Feeding difficulties
HP:0002020  |  Gastroesophageal reflux
HP:0001250  |  Seizures
HP:0000003  |  Multicystic kidney dysplasia
HP:0002209  |  Sparse scalp hair
HP:0000252  |  Microcephaly
HP:0000046  |  Scrotal hypoplasia
HP:0000448  |  Prominent nose
HP:0006443  |  Patellar aplasia
HP:0001249  |  Intellectual disability
HP:0002974  |  Radioulnar synostosis
HP:0000426  |  Prominent nasal bridge
HP:0006380  |  Knee flexion contracture
HP:0000280  |  Coarse facial features
HP:0003273  |  Hip contracture
HP:0008665  |  Clitoral hypertrophy
HP:0002104  |  Apnea
Text Mined Phenotype(Waiting for update.)
Disease ID 1228
Disease genitopatellar syndrome
Manually Symptom(Waiting for update.)
Text Mined Symptom(Waiting for update.)
Manually Genotype(Total Manually Genotypes:1)
Gene Mutation DOI Article Title
Genitopatellar syndromeKAT6BNM_012330, c.4100_4101insG (p.E1367Gfs*20)doi:10.1038/gim.2015.186
Text Mining Genotype(Total Genotypes:0)
(Waiting for update.)
All Snps(Total Genotypes:6)
snpId pubmedId geneId geneSymbol diseaseId sourceId sentence score Year geneSymbol_dbSNP CHROMOSOME POS REF ALT
rs199470469NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075028504ATTCAAGTAACTTGAA-
rs199470470NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075028593TCTA-
rs199470472NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075028612AA-
rs199470473NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075028626GA,T
rs199470475NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075028716GT
rs199470478NA23522KAT6Bumls:C1853566CLINVARNA0.241357209NAKAT6B;LOC1053783611075029184GAAAACCAGAAAAACCAAAA
GWASdb Annotation(Total Genotypes:0)
(Waiting for update.)
GWASdb Snp Trait(Total Genotypes:0)
(Waiting for update.)
Mapped by lexical matching(Total Items:14)
HP ID HP Name MP ID MP Name Annotation
HP:0002974Radioulnar synostosisMP:0000566synostosisosseous union of two bones that are not normally connected
HP:0000426Prominent nasal bridgeMP:0009903abnormal medial nasal prominence morphologyany structural anomaly of the central area of the two limbs of a horseshoe-shaped mesenchymal swelling that lie medial to the olfactory placode or pit in the future nasal region of the embryo; it joins with the ipsilateral maxillary prominence in the form
HP:0000750Delayed speech and language developmentMP:0012251abnormal diaphragm developmentmalformation or incomplete differentiation of the thin musculomembranous barrier separating the abdominal and thoracic cavities and functioning in respiration
HP:0001274Agenesis of corpus callosumMP:0013808abnormal tunnel of Corti morphologyany structrual anomaly of the triangular, fluid-filled space normally found between the inner and outer rows of supporting pillar cells in the organ of Corti
HP:0002213Fine hairMP:0010685abnormal hair follicle inner root sheath morphologyany structural anomaly of the multilayered tube composed of terminally differentiated hair follicle keratinocytes that is surrounded by the outer root sheath; the layers of the inner root sheath include the companion layer, Henle's layer, Huxley's layer a
HP:0001263Global developmental delayMP:0002084abnormal developmental patterningabnormal systematic arrangement of the developing body along an axis
HP:0002209Sparse scalp hairMP:0011195increased hair follicle apoptosisgreater than expected levels of programmed cell death of cells in the epidermis from which the hair shaft develops
HP:0000448Prominent noseMP:0002233abnormal nose morphologyany structural anomaly of the organ that is specialized for smell and is part of the respiratory system
HP:0001631Atria septal defectMP:0011667double outlet right ventricle with atrioventricular septal defecta form of DORV in which there is also a complete atrioventricular canal
HP:0000280Coarse facial featuresMP:0008018increased facial tumor incidencegreater than the expected number of neoplasms on the face, usually in the form of a distinct mass, in a specific population in a given time period
HP:0002089Pulmonary hypoplasiaMP:0013193sebaceous gland hypoplasiaunderdevelopment and decreased size of the sebum secreting glands of the hair shaft, usually due to a decrease in the number of cells
HP:0000046Scrotal hypoplasiaMP:0006226iris hypoplasiaunderdevelopment or reduced size of the iris, usually due to a reduced number of cells
HP:0000684Delayed eruption of teethMP:0020010decreased bone mineral density of femurreduction in the quatitative measurment value of mineral content of bone in the long bone of the thigh
HP:0000003Multicystic kidney dysplasiaMP:0011376abnormal kidney corticomedullary boundary morphologyany structural anomaly of the region demarcating the renal medulla from the surrounding cortex; end-stage renal failure may be associated with loss of the normal corticomedullary boundary
Mapped by homologous gene(Total Items:38)
HP ID HP Name MP ID MP Name Annotation
HP:0002974Radioulnar synostosisMP:0020039increased bone ossificationincrease in the formation of bone or of a bony substance, or the conversion of fibrous tissue or of cartilage into bone or a bony substance
HP:0001631Atria septal defectMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0001250SeizuresMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000046Scrotal hypoplasiaMP:0014198absent pituitary infundibular stalkabsence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland
HP:0002213Fine hairMP:0013897decreased eyelid cilium numberreduction in the number of the hairs that grow at the edge of the upper or lower eyelid
HP:0004322Short statureMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000347MicrognathiaMP:0020321increased vascular endothelial cell apoptosisincrease in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000316HypertelorismMP:0020321increased vascular endothelial cell apoptosisincrease in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0000445Wide noseMP:0014198absent pituitary infundibular stalkabsence of the apical portion of the tubular structure extending from the hypothalamus to the posterior lobe of the pituitary gland
HP:0000003Multicystic kidney dysplasiaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000126HydronephrosisMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0006443Patellar aplasiaMP:0013886increased CD4-negative, CD25-positive NK T cell numberincrease in the number of CD4-negative NK T cells expressing the activation marker CD25
HP:0011968Feeding difficultiesMP:0020234decreased basal metabolismdecrease in heat production of an organism at the lowest level of cell chemistry in an inactive, awake, and fasting state
HP:0000028CryptorchidismMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0003273Hip contractureMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0002804Arthrogryposis multiplex congenitaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000426Prominent nasal bridgeMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0006380Knee flexion contractureMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0008665Clitoral hypertrophyMP:0013886increased CD4-negative, CD25-positive NK T cell numberincrease in the number of CD4-negative NK T cells expressing the activation marker CD25
HP:0002104ApneaMP:0020187altered susceptibility to prion infectionaltered likelihood that an organism will develop ill effects from the small proteinaceous infectious particles which are resistant to inactivation by procedures that modify nucleic acids and which contain an abnormal isoform of a cellular protein that is
HP:0001263Global developmental delayMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0001249Intellectual disabilityMP:0020316decreased vascular endothelial cell proliferationdecrease in the expansion rate of any vascular endothelial cell population by cell division
HP:0003175Hypoplastic ischiaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000365Hearing impairmentMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0004279Short palmMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0002020Gastroesophageal refluxMP:0014178increased brain apoptosisincrease in the number of cells of the brain undergoing programmed cell death
HP:0000684Delayed eruption of teethMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0000280Coarse facial featuresMP:0020169increased thyroid gland weighthigher than average weight of the thyroid gland
HP:0000343Long philtrumMP:0020254decreased collagen leveldecreased level of the main structural protein of the various connective tissues in animals
HP:0001762Talipes equinovarusMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0001274Agenesis of corpus callosumMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0000946Hypoplastic iliaMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
HP:0000750Delayed speech and language developmentMP:0020309increased creatine kinase activityincreased ability of to catalyze the reaction: ATP + creatine = N-phosphocreatine + ADP + 2 H(+).
HP:0000369Low-set earsMP:0020321increased vascular endothelial cell apoptosisincrease in the timing or the number of vascular endothelial cells undergoing programmed cell death
HP:0002089Pulmonary hypoplasiaMP:0020214susceptible to malignant hyperthermiaincreased susceptibility to hyperthermia triggered by exposure to certain drugs used for general anesthesia, specifically the volatile anesthetic agents and the neuromuscular blocking agent, succinylcholine
HP:0000448Prominent noseMP:0020157abnormal behavioral response to alcoholany anomaly in the behavioral response induced by alcohol, such as induced hyperactivity or stereotypic behavior
HP:0000252MicrocephalyMP:3000003abnormal Ebner's gland morphologyany structural anomaly of the serous salivary glands which reside adjacent to the moats surrounding the circumvallate and foliate papillae just anterior to the posterior third of the tongue, anterior to the terminal sulcus; these exocrine glands secrete l
HP:0002209Sparse scalp hairMP:0020137decreased bone mineralizationdecrease in the rate at which minerals are deposited into bone
Disease ID 1228
Disease genitopatellar syndrome
Case(Waiting for update.)